diff -Nurd -x'*~' ncbitools-2.2.6.orig/LICENSE ncbitools-2.2.6/LICENSE --- ncbitools-2.2.6.orig/LICENSE 1969-12-31 19:00:00.000000000 -0500 +++ ncbitools-2.2.6/LICENSE 2005-12-29 00:24:13.000000000 -0500 @@ -0,0 +1,109 @@ + +Introduction + + The GenInfo Software Toolbox is a set of software and data exchange +specifications that are used by NCBI to produce portable, modular software for +molecular biology. We make this software and specifications available to the +community for use in its own right, or as a foundation for building other +tools with similar properties. All software produced by NCBI and here +provided includes the following copyright notice: + + ************************************************************************** + * * + * National Center for Biotechnology Information * + * Bldg. 38A, NIH, 8600 Rockville Pike, Bethesda, MD 20894 * + * * + * COPYRIGHT NOTICE * + * * + * This software/database is "United States Government Work" under the * + * terms of the United States Copyright Act. It was written as part of * + * the author's official duties as a Government employee and thus cannot * + * be copyrighted. This software/database is freely available to the * + * public for use without a copyright notice. Restrictions cannot be * + * placed on its present or future use. * + * * + * Although all reasonable efforts have been taken to ensure the accuracy * + * and reliability of the software and data, the National Library of * + * Medicine (NLM) and the U.S. Government does not and cannot warrant the * + * performance or results that may be obtained by using this software or * + * data. The NLM and the U.S. Government disclaims all warranties as to * + * performance, merchantability or fitness for any particular purpose. * + * * + * In any work or product derived from this material, proper attribution * + * of the author as the source of the software or data would be * + * appreciated. * + * * + ************************************************************************** + + In those cases where software is made available from other sources, +other restrictions may apply. + + It is available by anonymous ftp from ftp.ncbi.nih.gov. In the "toolbox" +directory you will find the following: + +Directory Structure + + These files are available for anonymous ftp from "ftp.ncbi.nih.gov". +The directory structure is as follows: + + toolbox - top level toolbox directory + ncbi_tools - NCBI software development toolkit and ASN.1 specs + most current version (3.xx). FTP the toolkit from + this directory. + other_ncbi - various other tools made by ncbi + other_tools - a few ASN.1 tools not made by ncbi + vms_utils - VMS tools for untarring and uncompressing + +ncbi_tools + + This is the NCBI portable software toolkit. A single compressed tar +file contains all the code, ASN.1 specifications, and demo programs +(including complete source code for Entrez). This file is: + +ncbi.tar.Z (Unix compressed tar file) +ncbiZ.exe (DOS, Windows PKZIP file) +ncbi.hqx (Mac self extracting archive) + +The contents of the files are the same except the UNIX version also includes +the documentation. Documentation is available in the ncbi_tools/newdoc +directory as MS Word file. A README in the files above explains installation. +Hardcopy of the documentation and questions my be directed to +toolbox@ncbi.nlm.nih.gov + +vms_utils + + This contains a set of utilities and instructions for VMS users to +untar and uncompress the files in the other directories. Get this first if +you are on VMS and read the instructions. Kindly maintained by Will Gilbert +of Whitehead Institute. Also contains other VMS utilities such as drivers +for ISO9660 CDROMS. +========================================================================== +in other_tools directory: + +isode + + This is a very large system of tools from ISO for use in prototyping +OSI applications. It includes many large tools in one file, and 5 volumes of +PostScript documentation in the other file. The documentation is good for +learning about OSI. There is an ASN.1 compiler which will give you the +flavor of what can be done with these tools. This is not a simple or terribly +efficient system. + + +osikit + + This is a set of tools from NIST (formerly the Bureau of Standards) +to assist development of OSI applications. It includes the free value tool, +which can read and validate an ASN.1 specification and produce an encoder and +decoder for both the print form and basic encoding rules form. We find it +very useful for checking syntax on both specifications and data objects. The +limitation is that in the print form, the tool can only accept VisibleStrings +all on one line, and less than 200 chars in length. + + +asn_pmp + + A parser for ASN.1 print files written by Peter Karp. It parses print +files into S expressions which makes a simple, flexible way to input data +objects. It does no checking on syntax or content. See the README for more +details. diff -Nurd -x'*~' ncbitools-2.2.6.orig/demo.fasta ncbitools-2.2.6/demo.fasta --- ncbitools-2.2.6.orig/demo.fasta 1969-12-31 19:00:00.000000000 -0500 +++ ncbitools-2.2.6/demo.fasta 2005-12-29 00:24:13.000000000 -0500 @@ -0,0 +1,4 @@ +>demo polylinker +CAGGAAACAGCTATGACCATGATTACGAATTCGAAGCTTAAGGCCTCCATGGATCCCGGGTCGACGCGTA +CGATATCGATGTCTAGATCTCCAGTACTAGTCTCGAGCTCTGCAGGGCCCGCGGTACCATGCATACTGGC +CGTCGTTTTACAACGTCGTGACTGGGAAAAC diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/corelib/ncbimisc.c ncbitools-2.2.6/ncbi/corelib/ncbimisc.c --- ncbitools-2.2.6.orig/ncbi/corelib/ncbimisc.c 2002-11-06 16:25:10.000000000 -0500 +++ ncbitools-2.2.6/ncbi/corelib/ncbimisc.c 2005-12-29 12:01:28.000000000 -0500 @@ -1123,28 +1123,6 @@ *****************************************************************************/ #if defined(OS_MAC) || defined(OS_UNIX_DARWIN) - -// 2001-03-22: Joshua Juran -// C2PStr() and P2CStr() do not exist in Carbon, so we roll our own. -# if TARGET_API_MAC_CARBON -static void C2PStr(char *ioStr) -{ - size_t len = strlen(ioStr); - if (len > 255) { - len = 255; - } - memmove(ioStr + 1, ioStr, len); - ioStr[0] = len; -} - -static void P2CStr(StringPtr ioStr) -{ - Byte len = ioStr[0]; - memmove(ioStr, ioStr + 1, len); - ioStr[len] = '\0'; -} -# endif - /* p_churchill 12/99 removed conditional compilation support for * THINKC and MPW */ diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/corelib/ncbithr.c ncbitools-2.2.6/ncbi/corelib/ncbithr.c --- ncbitools-2.2.6.orig/ncbi/corelib/ncbithr.c 2003-03-06 10:12:27.000000000 -0500 +++ ncbitools-2.2.6/ncbi/corelib/ncbithr.c 2005-12-29 00:29:02.000000000 -0500 @@ -2554,14 +2554,16 @@ } -NLM_EXTERN Int4 NlmCPUNumber(void) -{ #if defined(OS_UNIX_DARWIN) #include #include #include +#endif +NLM_EXTERN Int4 NlmCPUNumber(void) +{ +#if defined(OS_UNIX_DARWIN) host_basic_info_data_t hinfo; mach_msg_type_number_t hinfo_count = HOST_BASIC_INFO_COUNT; kern_return_t rc;